ID: 1022171626_1022171635

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1022171626 1022171635
Species Human (GRCh38) Human (GRCh38)
Location 7:27837390-27837412 7:27837421-27837443
Sequence CCTCCCATGGCTTTGGGGCTCAG CCACATTTCCCCGTTCCCATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!