ID: 1022176448_1022176452

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1022176448 1022176452
Species Human (GRCh38) Human (GRCh38)
Location 7:27875834-27875856 7:27875867-27875889
Sequence CCTAGTTATACCTGGAAAACTAG AGGAGCTAAAATGAATGTTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 211} {0: 1, 1: 0, 2: 2, 3: 23, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!