ID: 1022186250_1022186262

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1022186250 1022186262
Species Human (GRCh38) Human (GRCh38)
Location 7:27972377-27972399 7:27972413-27972435
Sequence CCTGAGCTGGGTGTGCTCAAGGG CTCTTTTAGGGGAAGGAGGATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 43, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!