ID: 1022201658_1022201665

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1022201658 1022201665
Species Human (GRCh38) Human (GRCh38)
Location 7:28123106-28123128 7:28123151-28123173
Sequence CCCTCTCTCCTCTAGCCACACTG GTTAAGTTGCTTTCTGTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 13, 3: 100, 4: 569} {0: 1, 1: 0, 2: 1, 3: 29, 4: 318}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!