ID: 1022227670_1022227672

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1022227670 1022227672
Species Human (GRCh38) Human (GRCh38)
Location 7:28380436-28380458 7:28380475-28380497
Sequence CCAGGTCTGCTGCGATGGTGCTA CAAAAGGAAGAATCCCACTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55} {0: 1, 1: 0, 2: 2, 3: 47, 4: 429}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!