ID: 1022258044_1022258048

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1022258044 1022258048
Species Human (GRCh38) Human (GRCh38)
Location 7:28678844-28678866 7:28678884-28678906
Sequence CCTTGCAGAAACCCTCTTAATAA TCTCTGCTCAGTGTAAGAGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 25, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!