ID: 1022310876_1022310879

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1022310876 1022310879
Species Human (GRCh38) Human (GRCh38)
Location 7:29194801-29194823 7:29194823-29194845
Sequence CCGGAGGCTGGTGCTTTCTGCGC CGTCCCCAGGACTTTGCCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 151} {0: 1, 1: 0, 2: 1, 3: 13, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!