ID: 1022319676_1022319677

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1022319676 1022319677
Species Human (GRCh38) Human (GRCh38)
Location 7:29277005-29277027 7:29277020-29277042
Sequence CCATTTCTTGATTTAGTGGGTTA GTGGGTTACCACATGTTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 267} {0: 1, 1: 0, 2: 0, 3: 15, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!