ID: 1022363375_1022363386

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1022363375 1022363386
Species Human (GRCh38) Human (GRCh38)
Location 7:29685054-29685076 7:29685079-29685101
Sequence CCCGCGGCGGCGGCCTCCGGCCC GGCTCTGGTCCCGGTCCCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 42, 4: 373} {0: 1, 1: 0, 2: 1, 3: 10, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!