ID: 1022407848_1022407849

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1022407848 1022407849
Species Human (GRCh38) Human (GRCh38)
Location 7:30108809-30108831 7:30108827-30108849
Sequence CCTTTGGCAGGAGGGTCTGTGGC GTGGCTTTCCACAGCACCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 196} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!