ID: 1022410710_1022410717

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1022410710 1022410717
Species Human (GRCh38) Human (GRCh38)
Location 7:30136380-30136402 7:30136403-30136425
Sequence CCCAAATGTAAGATGGAGGCGGC CGTGGGCGCGGGTGACCGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 50} {0: 1, 1: 0, 2: 0, 3: 11, 4: 92}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!