ID: 1022414010_1022414013

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1022414010 1022414013
Species Human (GRCh38) Human (GRCh38)
Location 7:30162718-30162740 7:30162746-30162768
Sequence CCATGTAATTACCATTCGCTTGC AAGAGCCTTTCAAACTCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 51} {0: 1, 1: 0, 2: 2, 3: 17, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!