ID: 1022451672_1022451673

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1022451672 1022451673
Species Human (GRCh38) Human (GRCh38)
Location 7:30521900-30521922 7:30521941-30521963
Sequence CCTTTTACAACTTACTCTCAAAA AACCACATTCTATTATTTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 34, 4: 361} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!