ID: 1022481237_1022481244

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1022481237 1022481244
Species Human (GRCh38) Human (GRCh38)
Location 7:30744369-30744391 7:30744410-30744432
Sequence CCCCACCTCGCTCTGGCAACTCC CCCTGCCCAACTGTGCATGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 242} {0: 1, 1: 0, 2: 2, 3: 24, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!