|
Left Crispr |
Right Crispr |
| Crispr ID |
1022491583 |
1022491590 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:30824664-30824686
|
7:30824695-30824717
|
| Sequence |
CCTGGGCTTCAGCGATCCTCCCA |
TCCTGAGTAGCTGGGATTACAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 9, 1: 362, 2: 5645, 3: 30290, 4: 65889} |
{0: 53511, 1: 140483, 2: 228049, 3: 201895, 4: 144651} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|