ID: 1022493661_1022493664

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1022493661 1022493664
Species Human (GRCh38) Human (GRCh38)
Location 7:30839645-30839667 7:30839681-30839703
Sequence CCTTCTTAGGCTGATCATTGAGA TTGCAGATAGAGCTGGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 110} {0: 1, 1: 0, 2: 3, 3: 28, 4: 304}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!