ID: 1022494722_1022494735

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1022494722 1022494735
Species Human (GRCh38) Human (GRCh38)
Location 7:30845691-30845713 7:30845734-30845756
Sequence CCCACCTCAGATGTTGCCCACCA CTGTGAAAGCAGATGGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 204} {0: 1, 1: 1, 2: 9, 3: 71, 4: 550}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!