ID: 1022496591_1022496596

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1022496591 1022496596
Species Human (GRCh38) Human (GRCh38)
Location 7:30856775-30856797 7:30856800-30856822
Sequence CCAAGAGCTTCGTGACTTCCCTA CAGCATGCAGAGCTGGTACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 82} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!