ID: 1022498707_1022498715

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1022498707 1022498715
Species Human (GRCh38) Human (GRCh38)
Location 7:30869160-30869182 7:30869205-30869227
Sequence CCCCCAGGAGGACATGGAGGAGA GTTAAGTCAGTCTTTGGTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 376} {0: 1, 1: 0, 2: 1, 3: 8, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!