ID: 1022498984_1022498998

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1022498984 1022498998
Species Human (GRCh38) Human (GRCh38)
Location 7:30870950-30870972 7:30870994-30871016
Sequence CCTCCCAGAGTCAAGTGTGCCTC AGGGTCCAGTGTGACCCCCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 17, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!