ID: 1022515381_1022515386

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1022515381 1022515386
Species Human (GRCh38) Human (GRCh38)
Location 7:30971915-30971937 7:30971941-30971963
Sequence CCCTCTCCCTGCTTGCTTCTTGT TCATTTCTCCCATTACCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 674} {0: 1, 1: 0, 2: 2, 3: 19, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!