ID: 1022515382_1022515387

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1022515382 1022515387
Species Human (GRCh38) Human (GRCh38)
Location 7:30971916-30971938 7:30971944-30971966
Sequence CCTCTCCCTGCTTGCTTCTTGTT TTTCTCCCATTACCCCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 65, 4: 586} {0: 1, 1: 2, 2: 39, 3: 598, 4: 818}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!