ID: 1022517853_1022517859

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1022517853 1022517859
Species Human (GRCh38) Human (GRCh38)
Location 7:30987240-30987262 7:30987254-30987276
Sequence CCAGAGGCTGGCAGGTGGGTGTG GTGGGTGTGTGGCCTGGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 63, 4: 549} {0: 1, 1: 0, 2: 9, 3: 210, 4: 1833}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!