ID: 1022526342_1022526354

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1022526342 1022526354
Species Human (GRCh38) Human (GRCh38)
Location 7:31040069-31040091 7:31040114-31040136
Sequence CCACCCCTCCAAAAAAAAAATGT TTGGATTCTCTGTAAATAATGGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 59, 3: 456, 4: 2817} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!