ID: 1022526343_1022526354

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1022526343 1022526354
Species Human (GRCh38) Human (GRCh38)
Location 7:31040072-31040094 7:31040114-31040136
Sequence CCCCTCCAAAAAAAAAATGTTTA TTGGATTCTCTGTAAATAATGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 22, 3: 245, 4: 1868} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!