ID: 1022529245_1022529254

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1022529245 1022529254
Species Human (GRCh38) Human (GRCh38)
Location 7:31056907-31056929 7:31056958-31056980
Sequence CCCAAATCCATCCAGGGGGCGCT CTTGCCTGTGCCAGGTGCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 12, 3: 68, 4: 726}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!