|
Left Crispr |
Right Crispr |
| Crispr ID |
1022579764 |
1022579770 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:31539678-31539700
|
7:31539729-31539751
|
| Sequence |
CCTGAGAGGGGCTTCTGGCTGAT |
CTAAGGTTATTTAAGGGTTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 29, 1: 69, 2: 89, 3: 110, 4: 223} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|