ID: 1022594396_1022594402

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1022594396 1022594402
Species Human (GRCh38) Human (GRCh38)
Location 7:31698375-31698397 7:31698407-31698429
Sequence CCTCTATCTATCCCTTCGTCTTC CTGTATACCAAGATGAATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 302} {0: 1, 1: 0, 2: 0, 3: 10, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!