ID: 1022624644_1022624652

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1022624644 1022624652
Species Human (GRCh38) Human (GRCh38)
Location 7:32022479-32022501 7:32022509-32022531
Sequence CCAAGGAGAAGTCATGAATGTGG TGGGGTGATGGGGAATGAAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 65, 4: 750}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!