ID: 1022652162_1022652173

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1022652162 1022652173
Species Human (GRCh38) Human (GRCh38)
Location 7:32287410-32287432 7:32287445-32287467
Sequence CCATCCCAATCCCCAGACAAATT TGGGCATGACCACAGCACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 258} {0: 1, 1: 0, 2: 1, 3: 31, 4: 252}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!