ID: 1022652509_1022652521

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1022652509 1022652521
Species Human (GRCh38) Human (GRCh38)
Location 7:32290158-32290180 7:32290199-32290221
Sequence CCCCAAAGCAGCTGGCACCAATT GCACCCGGCTTGGCTGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 151} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!