ID: 1022673439_1022673442

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1022673439 1022673442
Species Human (GRCh38) Human (GRCh38)
Location 7:32477020-32477042 7:32477057-32477079
Sequence CCCAACACAGGTGTCAGATGGAA TGTCTATGCATGCTCATTTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 65, 4: 951}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!