ID: 1022675518_1022675529

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1022675518 1022675529
Species Human (GRCh38) Human (GRCh38)
Location 7:32495576-32495598 7:32495627-32495649
Sequence CCGATCTCCCTGTGCGGCCCTCA CGCGGCTTTCCGCACACGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 192} {0: 1, 1: 0, 2: 0, 3: 0, 4: 12}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!