ID: 1022694416_1022694424

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1022694416 1022694424
Species Human (GRCh38) Human (GRCh38)
Location 7:32690215-32690237 7:32690243-32690265
Sequence CCACATCCCTCATCTTTCACCAT CCCTCCTACTCACCTTCTTCAGG
Strand - +
Off-target summary No data {0: 3, 1: 1, 2: 1, 3: 23, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!