ID: 1022694655_1022694665

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1022694655 1022694665
Species Human (GRCh38) Human (GRCh38)
Location 7:32692480-32692502 7:32692528-32692550
Sequence CCACACCATCTCTGTGTAGTGAG GTGAAGGGGTGAAACTAGGAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 9, 4: 170} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!