ID: 1022725220_1022725221

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1022725220 1022725221
Species Human (GRCh38) Human (GRCh38)
Location 7:32975197-32975219 7:32975210-32975232
Sequence CCAATTCAGTGCTTCATTTTGAT TCATTTTGATGTACTTCTGATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 23, 4: 282} {0: 2, 1: 0, 2: 0, 3: 25, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!