ID: 1022726195_1022726198

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1022726195 1022726198
Species Human (GRCh38) Human (GRCh38)
Location 7:32984051-32984073 7:32984081-32984103
Sequence CCTGTTATGTTGTTAAATACATT CTCATTATGGTTCCTGTCTTTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 7, 3: 35, 4: 352} {0: 1, 1: 1, 2: 0, 3: 13, 4: 166}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!