ID: 1022731884_1022731888

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1022731884 1022731888
Species Human (GRCh38) Human (GRCh38)
Location 7:33034283-33034305 7:33034329-33034351
Sequence CCTTCAACAGTCTGAATAACTGT CTCCACAAACACCTTCTAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!