ID: 1022747058_1022747062

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1022747058 1022747062
Species Human (GRCh38) Human (GRCh38)
Location 7:33183203-33183225 7:33183224-33183246
Sequence CCCCCAAAATGGAGTCTGCAGCA CACCTCCTCTGTTTTTCCCAAGG
Strand - +
Off-target summary No data {0: 19, 1: 36, 2: 67, 3: 95, 4: 413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!