ID: 1022749992_1022750002

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1022749992 1022750002
Species Human (GRCh38) Human (GRCh38)
Location 7:33214290-33214312 7:33214331-33214353
Sequence CCTCAAGTCACTGTGCTGTCCCT CTACACTGGGGTATGAGGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 13, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!