ID: 1022882185_1022882191

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1022882185 1022882191
Species Human (GRCh38) Human (GRCh38)
Location 7:34599559-34599581 7:34599583-34599605
Sequence CCCATGTACTAATATGTCCTAGG CACTGCAGTCAACTTGCAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77} {0: 1, 1: 0, 2: 0, 3: 17, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!