ID: 1022916372_1022916375

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1022916372 1022916375
Species Human (GRCh38) Human (GRCh38)
Location 7:34958560-34958582 7:34958612-34958634
Sequence CCTTATGTGTATACCTTATGTGC GAAGTGAAATTGATGGATCAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 142} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!