ID: 1022920325_1022920330

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1022920325 1022920330
Species Human (GRCh38) Human (GRCh38)
Location 7:35006473-35006495 7:35006510-35006532
Sequence CCAATGCTCCTTCTTACTTGCAG CACACTGGGTCTTAAGAAACTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 12, 4: 179} {0: 1, 1: 1, 2: 1, 3: 13, 4: 174}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!