ID: 1022920331_1022920334

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1022920331 1022920334
Species Human (GRCh38) Human (GRCh38)
Location 7:35006533-35006555 7:35006550-35006572
Sequence CCTTCAGAAACTGTTAGTCTGTG TCTGTGGCTAAGAAATATCAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 11, 4: 199} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!