ID: 1022922727_1022922734

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1022922727 1022922734
Species Human (GRCh38) Human (GRCh38)
Location 7:35032883-35032905 7:35032921-35032943
Sequence CCAATTTCTCTCCATCTCCACAG AGGCCAGCAACCCTCTTGCTAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 20, 3: 193, 4: 906} {0: 1, 1: 0, 2: 1, 3: 7, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!