ID: 1022972136_1022972147

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1022972136 1022972147
Species Human (GRCh38) Human (GRCh38)
Location 7:35528151-35528173 7:35528188-35528210
Sequence CCCAGTTCCAGCTGGGCCTCCAG CTTGGGTAGAGAGAAGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 345} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!