ID: 1023030246_1023030254

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1023030246 1023030254
Species Human (GRCh38) Human (GRCh38)
Location 7:36084735-36084757 7:36084779-36084801
Sequence CCACTGCTGGAGTTAATGATCCA CCACACTGGCCGCTGGCGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 103} {0: 1, 1: 0, 2: 0, 3: 10, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!