ID: 1023035751_1023035761

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1023035751 1023035761
Species Human (GRCh38) Human (GRCh38)
Location 7:36130179-36130201 7:36130231-36130253
Sequence CCCACAAAAACAGAGAGTATAAA GAGCCACTGGGACCCCTGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 19, 4: 197}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!