ID: 1023038828_1023038836

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1023038828 1023038836
Species Human (GRCh38) Human (GRCh38)
Location 7:36154758-36154780 7:36154808-36154830
Sequence CCCAGCTCATGAGCGTGCGAGGC GTGGACTTCCGCCGTGAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 39} {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!