ID: 1023047407_1023047414

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1023047407 1023047414
Species Human (GRCh38) Human (GRCh38)
Location 7:36222708-36222730 7:36222740-36222762
Sequence CCATTTCCTAGTTCATAGATGGC CGGGGTCCCCACTTGGTGGAAGG
Strand - +
Off-target summary {0: 3, 1: 23, 2: 135, 3: 294, 4: 597} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!